Benefits of Plea Bargaining Essay Example | Topics and Well Written Essays - 1500 words

Benefits of Plea Bargaining - Essay Example Plea bargaining is the procedure through which a person accused for an offense concurs to appeal for being culpable to a slighter crime in switch over for a gentle punishment, a lessening of accuses, or further advantages. For years judges, prosecutors, and lawyers have acknowledged plea bargaining for speediness of the execution of the packed courts. Plea bargaining is being gradually more disparaged, though, it does not press the trial to confirm the defendant's fault further than a logical uncertainty, refutes the charged one a adjudicators tribunal, and permits various defendants to descend very imperceptibly. (Fisher, 2004) The plea bargaining practice is quite well institutionalized in the judicial system of USA. It seems to function proficiently and speedily. However, there is always a question whether this current day practice is capable of defending the legitimate civil liberties and to attain ultimate fairness and impartiality consistent with the USA perception correct procedure expressed by criminal justice judicial system or whether it has simply turned into a superficial and ineffective process a self governing status. (Fisher, 2007) 1. Benefits of Plea Bargaining 1. As stated by Jones (1978) flexibility is being provided through plea bargaining which is necessary for changing for turning out substantive fairness. However, in spite of or because of its predominance, plea bargaining still stay a notorious exercise in the world of crime and punishment. The concern that blameless defendant may appeal accountable stimulates frequently impassioned argument about the topic. 2. An agreement made between the charged individual and the prosecutor whereby the defendant may appeal guilty to switch over to either a slighter punishment or an abridged accuse, is usually referred as Plea Bargaining. (Alschuler, 1979) He further states that the agreement of plea bargaining takes place between the offender and the prosecutor to enable the defendant to avail reduced sentence and presently in US criminal act convictions almost 95% are resolved through such plea bargaining. Characteristically, such agreements can be divided into three types: Verdict bargaining Count bargaining Charge bargaining. 3. When there is no certainty of the ultimate judgment of a hearing, the defendant may take a benefit of plea of guilty by copping a plea, as an alternative of attending the trial. This will lessen the ambiguity of the hearing. Thus, in this case the plea bargain seems to provide a liberty of selection to the charged individual. 4. As viewed from the perception of the state, plea bargaining is beneficial in terms of economizing both time and resources while obtaining a guilty conviction. The fact is recognized by all legal experts that each and every filed case is not meant for a trial otherwise the entire judicial system may disintegrate if so many trials are executed. (Amoury, 2002) 5. The plea bargaining seems to be more impartial for both the witnesses and potential judges. It is imaginable that

Birthright citizenship in the United States of America Essay Example for Free

Birthright citizenship in the United States of America Essay In â€Å"Americanism,† Theodore Roosevelt describes the meaning of hyphenated Americans and their lives in the United States. There was no room in Roosevelt’s America for immigrants or sons of immigrants, who cling to the speech, the customs, the way of life, and the habits of thought from the old world which they have left. The hyphenated American is not an American at all. Those immigrants who hyphenated their Americanism, modifying it with the land of their or their parents’ birth, were and could not be true Americans. These Americans also can vote and be the primarily citizen of a foreign country. Roosevelt writes that the foreign-born population must be an Americanized population. They must talk the language of its native-born fellow-citizens; possess American citizenship, American ideas and maintain an American standard of living. The immigrants must not to be allowed to drift or to be put at the mercy of the exploiter. According to Roosevelt, America cannot afford to keep a lot of immigrants as industrial assets and not as human beings. We also cannot pay low wages to immigrants, and keep immigrants working on American mines, railways or working in our munitions plants because it is dangerous. All United States citizens must stand shoulder to shoulder for the elimination of race and religious prejudice. We must also improve maintenance of the American standard of living; direct every national resource, material and spiritual, and train our people to overcome difficulties. We can do all this work in a democratic country where all people have equal rights and hopes for a good future life.

Comparing Tragedy in Oedipus the King and Antigone :: comparison compare contrast essays

Oedipus the King More Tragic then Antigone   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Sophocles was a master of tragedy, thereÕs no argument there. But which of the 2 plays weÕve studied, Oedipus the King and Antigone, is the more tragic? I believe that Oedipus the King was more intensely tragic and I think that if I were to see a the plays Ã’back to back,Ó Oedipus would be the more likely one to rivet true emotions from me. I think OedipusÕ cathartic value can be seen clearly when you compare the entirety of the results in both plays.    In Antigone, she loses 2 brothers, and then a lover, and finally her life. Oedipus loses his self-confidence, his true father, his true mother, his Ã’adoptiveÓ father, his wife, his integrity, his people, and his sight. When you weigh the two, Oedipus is obviously the more tragic, in this one area at least. Certainly one must see that Oedipus goes through a more cathartic tragedy than Antigone when one looks at the circumstances under which the tragedy falls as well. Antigone knew full well that what she was doing was wrong. She knew that if she buried her brother bad things would happen and she was ready and willing to die. Oedipus on the other hand actually thought he was doing the city some good by searching out the killer of Laius. He thought everything was going to turn out just fine in the end, which makes his downfall that much worse. A point that also must be considered is hybris. Many people donÕt feel like they can relate to Oedipus because of his hybris, whereas Antigone is a very palpable sort of character, very down to earth and a Ã’peopleÕs heroÓ so to speak. She is strong, and willing to die for her cause.

Impact of Education Choice on Public Funds Essay

Brown v. Board of Education of Topeka, 347 U. S. 483 (1954), was a landmark decision of the United States Supreme Court that declared state laws establishing separate public schools for black and white students unconstitutional. Though the U. S. Supreme Court declared school desegregation in the 1954 ruling on the famous â€Å"Brown v. Board of Education† case, the state of Mississippi did not allow racially or ethnically different students to mix together in schools until 1970, sixteen years after the 1954 Supreme Court ruling, according to the Civil Rights Timeline, created by the Mississippi Humanities Council at Southern Mississippi. Brown v. Board of Education prompted parents in Mississippi to create nonpublic and charter schools in efforts to keep schools segregated. Legislation and School Choice in Mississippi At the present time, Mississippi doesn’t truly offer school choice. There is no private school choice program. Parents are not given money from the state to send their children to private or parochial schools. The Education Commission of the States reports that Mississippi has enacted a mandatory inter-district school open enrollment policy. Students can move between school districts- but that is not guaranteed for those who want to change schools. Both the sending and receiving school boards must approve it. Mississippi’s Constitution prohibits the appropriation of any state education funds for the support of sectarian schools or private schools (Miss. Const. Art. 8, Sec. 208). Though at the same time, state accreditation is mandatory for nonpublic schools receiving state funds. According to State Regulation of Private Schools, (June 2000), Mississippi law provides free textbooks on loan to pupils in all elementary and secondary schools in the state (Miss. Code Ann.  § 37-43-1 et seq). The loan of textbooks to qualified private schools does not violate Mississippi’s constitutional prohibition against public support of sectarian schools or the control of educational funds by religious sects. Private, parochial or denominational schools accepting free school textbooks on behalf of their students must file annual reports as required by the State Board of Education (Miss. Code Ann.  § 37-43-51). Throughout the years, numerous bills to give vouchers or tax credits/ tax deductions have died in House Committees. It was allowed to die in 2009. During the 12 years that the law was on the books, only one traditional public school converted to a public charter school. Senate Bill 2721 is the latest bill in regards charter schools. This current bill is one authorizing new start-up charter schools to be established in Mississippi recently passed the State Senate and is now being taken up in the House of Representatives. Senate Bill 2721, which passed the senate by a vote of 50-2 in February, authorizes five new start-up charter schools to be established in the state. With this bill, the school can be brand new, not a failing school converting to a charter. Local school boards would have the first look at proposals, but authorization power would still rest solely with the state board of education. According to Bill 2721, the definition of a start-up charter school is â€Å"a public school operating under the terms of a charter granted by the State Board of Education with the approval of the local school board or school boards on the application of an eligible entity and may draw its students from across public school district boundaries† (Harrison, 2010) . Previous attempts to expand charter schools in Mississippi were shot down by fears of racial segregation. Some fear that it is a backdoor attempt to re-segregate many of Mississippi’s public schools, though supporters point out that a majority of charter school students in many parts of the country are minorities. â€Å"There’s been some resistance from the Mississippi Association of Educators and other groups that say you’re taking money from public education,† Watson continued (Harrison, 2010). â€Å"That’s an absolute falsity—this is public education† (Harrison, 2010). Opposition still remains from some caucus members and from teacher unions (Heartland. org). Those who oppose the potential implementation of charter schools believe the schools will be taking away students, resources and funding from a public school system that is already heavily financially burdened. Impacts on Funding and Analysis Mississippi charter schools are eligible for the same funding as regular schools. They may receive federal, state, local or private funding. They are not taxing authorities and may not levy taxes or request tax increases in order to generate funding. Charter schools are funded with taxes, but operate with more flexibility and fewer restrictions than the traditional public schools. Often times, charter schools have a special emphasis, such as on the art or the sciences. According to the Mississippi Code of 1972, â€Å"the State Board of Education may give charter schools special preference when allocating grant funds other than state funds for alternative school programs, classroom technology, improvement programs, mentoring programs or other grant programs designed to improve local school performance†. Allowing charter schools to be created will minimally decrease the funding that public schools receive. Minimal because at most only five charter schools will come into existence and they will be spread throughout the state, not centralized in one location. The amount of funding will still be based on the number of students enrolled in the schools. Charter schools traditionally keep their numbers small. Jackson public schools is the third largest district in the state of Mississippi, none of these legislations are negatively impacting the funding of the district. Even the state law allowing book loans to private schools has not taken away from the students of JPS. It has been speculated that having a charter school law would make Mississippi eligible for more grants through the Race to the Top program, which is part of the stimulus package passed last year by Congress and signed into law by Obama. If this speculations is true, then all districts in the state are losing funds due to lack of charter schools. But the state Department of Education has said the lack of a charter school law would not prevent Mississippi from being eligible for the grants through the program (heartland. org).

Mcdonalds Global Perspective

McDonald’s Implementation of Current Strategic Plan Synopsis: This is a two page APA citation style essay on Management at McDonald’s. There are eleven sources cited in this essay. The historical thinker whose successes will be correlated to McDonald’s strategic plan is Alexander the Great. The elements involved in organizational strategic planning will be explored. Introduction The strategic plan of McDonald’s has gained worldwide success over the past seventy years of its existence. (McDonald’s, 2012).Mcdonald’s is a worldwide brand which has achieved global recognition of it’s brand and products. McDonald’s began as McDonald’s Bar- B-Q Restaurant in San Bernardino, CA in 1940. Today McDonald’s is a premier global restaurant brand with 330,000 franchises. The McDonald’s franchises attend to over 64,000,000 customers on a daily basis in over 118 countries (McDonald’s, 2012)Alexander the Great was a h istorical thinker who started with a small military force of only 40,000 men and ruled over an empire which extended from the Mediterranean to China.Alexander the Great accomplished this by the application of transactional, transformational and laissez faire leadership (Kilfoil, n. d; Eagley et al. , 2003). Effectively Implementing a Current Strategic Plan in an Organization Both Mcdonald’s and Alexander the Great have gained their successes by application of seven identifiable leadership endeavors which are components of strategic leadership. These components with regards to efficient strategy implementation are: ? Researching a plan of action. ? Formulating a plan of action. Ascertaining strategic orientation including leadership roles. ? Setting equitable organizational limits. ? Efficiently administration of the organizational assets, revenues and liabilities. ? Maintenance of an organizational perspective. ? Promotion of organizational values and ethics (Joomla & Fourie, 2009). These are components of McDonald’s organizational administration (McDonald’s, 2012). Alexander the Great also applied effective organizational management techniques (Kilfoil, n. d. ). In order to properly allocate resources, proper data and research must be acquired.The data for these population studies may be analyzed by application of bar graphs, charts or scatter plots in order to effectively assess data (McCoy & Kinyua, 2012). The elements of organizational culture consists of the physical domains of its framework, semantic regional expressions, ceremonial observances, historical antecedents, belief systems, ethics and mental models. The best manner of shaping corporate culture to fit strategy is to continuously train and educate employees (McShane- Von Glinow, 2002).In exercising strategic leadership, the application of transactional , transformational and laissez faire leadership models are required for the strategic leadership of an organization (Eagly e t al, 2003(. Alexander the Great realized the importance of entertaining his military force with recreational activities *Kilfoil, n. d. ). In order to build a capable organization, the organization must be able to apply leverage to the member’s aptitudes along with the elements of administration, structure and accountability processes and methodologies (Lewis, n. d. . Strategic implementation is the procedure of enabling the organizational management techniques. It is the aggregate of the occupations and perspectives required for the effective implementation of a strategic design (Khaliq, 2011). Best practices are defined by the precise application of aptitudes, implements and strategies which can facilitate the potential of success in a wide range of organizational endeavors. This consists of an empirical process which is supported by organizational consensus. There are five elements to carrying out strategic roles.These elements are processes, individuals, compliance with regulatory statutes, effective administration and the efficient application of technological resources (Span, 2012). A correctly planned extrinsic motivational implementation model is enable organizational managers to provide the most effective tool for encouraging organizational commitment in order to carry out the organizational management objectives (Thompson, 2009). Conclusion The Mcdonald’s organization and the Grecian Empire of Alexander the Great were both able to expand by considering the needs of their members along with the rganizational objectives. The employees and members enable the effective implementation of management policy. In the effective application of strategic leadership with strategy implementation, the empirical outcome has been shown to be successful (Jooste & Fourie, 2009). References Eagly, A. (2003) Transformational, Transactional, and laissez faire leadership styles: a meta analysis comparing men and women. Psychol Bull 2003 Jul; 128(4): 569- 91 http://www. ncbi. nlm. nih. gov/pubmed/12848221 Jooste, C. & Fourie, B. 2009) The role of strategic leadership in effective strategy implementation: Perception of South African strategic leaders. South African Business Review, 13(3) http://www. ajol. info/index. php/sabr/article/viewfile/76341/6679 Khaliq, N. (2011) Business Policy and Strategy http://www. scribd. com/doc/52995555/Business-policy-and-straegy-implemtation Kilfoil, E. (n. d) Alexander the Great http://atschool. eduweb. co. uk/sirrobhitch†¦ /ezra. html Lewis, K. (n. d. ) The Project Capable Organization White Paper Lewis and Fowler, LLC http://www. ewisandfowler. com/white_papers/L%26F_Proj_capable_Org. pdf McCoy, D. & Kinyua, K. (2012) Allocating Scarce Resources Strategically- An Evaluation and discussion of the Global Funds Pattern of Disbursements PLoS ONE May 7(5): 1- 4 Mcdonald’s Food Corp. (2012) History http://www. aboutmcdonalds. com McShane, S. & Von Glinow, M. (2002) Organizational Behavior, Part Four Organizational Processes McGraw Hill Companies, 2002 http://www. govrelations. cornell. edu/govrelations/pdf/upload/organizational_behavior behavor_MCShane_Chap15_VIEW. df Span, S. (2012) Where Are We Going and How Do We Get There? Conducting Strategic Planning Tolere Solutions HR. com http://www. hr. com/en? t=/†¦ s Thompson, A. (2009) Strategia aziendale- Formulazione ed ezecuzione McGraw Hill Companies http://www. ateneonline. it/thompson/studenti/approfondimenti/isbn6622-3_ch12. pdf Weeraretne, D. (2010) Project Management Best Practices- for continuous improvement The Sunday Times, Education http://www. sundattimes. lk/100221/Education/edu05. html

The Musical 1776 essays

The Musical 1776 essays The movie titled 1776 is an excellent musical version of what happened at the Continental Congress in the months leading up to the signing of the Declaration of Independence on July 4, 1776. The original thirteen colonies signed this declaration and agreed to separate from England thus the United States of America was formed. Tension with Englands King George III was at an all-time high. Colonists were frustrated with the actions of their rulers overseas. Taxes were placed on them, and British soldiers occupied their towns and cities. A few members of the Continental Congress began speaking of independence. In the musical version of 1776, viewers are given a new perspective on the writing of the document. The Movie shows the date of June 6 1776 with our forefathers in Philadelphia discussing what they should do about the adoption of independence. The following scenes focus on events that surround the beginning of this country's most historic document; the Declaration of Independence. It is wonderful how the movie has a historical accuracy. The set was interesting; it showed colonial houses and the downtown area of Philadelphia that revealed the chambers where the delegates met. This brought an authentic look to the show. This movie focuses mainly on the character of John Adams as he tries to pass a motion for independence. John Adams was in Philadelphia for more than a year before his goal of gaining independence started to originate. His dream appears to be unattainable until Virginia backs his cause. On June 7, Richard Henry Lee of Virginia proposed to the Continental Congress the resolution calling for a Declaration of Independence: that "these United Colonies are, and of right ought to be, free and independent States..." Teaming up with Benjamin Franklin and Thomas Jefferson, Adams manages to overcome obstacles by the loyalists who supported England in Pennsylvania and the slaveholders in Georgia, North Car...

Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids The WritePass Journal

Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids Abstract Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids Abstract1. Introduction1.1 Schistosomiasis1.2 Genetic diversity; transmission and epidemiology of S.mansoni1.3 Drug resistance and vaccine development1.4 Mitotic recombination in the S. mansoni life cycle causing genetic variation1.5 Studying the genetic diversity of S.mansoni using molecular techniques2. Materials and Methods  2.1 Bioinformatics – RAPD primers2.2 Comparison of DNA extraction methods: Beltran et al. (2008) and DNeasy protocol2.3 Amplification of cercariae and Schistosome hybrid DNA by Polymerase chain reaction (PCR) using RAPD primers2.4 Analysis of RAPD PCR products 2.5 Amplification of schistosome hybrid DNA by polymerase chain reaction (PCR) using ITS-2 primers and the analysis of the PCR products3. Results3.1 Bioinformatics – RAPD primers  3.2 PCR products from the amplification of DNA from cercariae using RAPD markers3.3 PCR products from the amplification of DNA from schistosome hybrids using RAPD markers3.4 PCR products from the amplification of DNA from schistosome hybrids using ITS -2 primers4. Discussion4.1 DNA extraction4.2 Evidence of mitotic recombination in Schistosomes4.3 The use of RAPD and rDNA markers in emphasising genetic diversity within schistosomesReferencesRelated Abstract Random amplified polymorphic DNA markers and second internal transcriber region primers   have been used to assess the genetic diversity of Schistosoma mansoni and Schistosoma rodhaini hybrids. 20 schistosome hybrids were used and within these parasites 6 different genotypes were present. However,1 genotype was   in females and in males and so was not sex specific. The genetic diversity within this parasite population is caused by mitotic recombination occurring in the asexual stage of the life style.   This is thought to occur due to its ability of evading the snail immune system, hybrid breakdown and increased movement and turn over of the snail host. The Red Queen Hypothesis is also suggested as a reason for genetic diversity in the schistosome population. Key words: Schistosoma mansoni, Schistosoma rodhaini, DNA extraction, polymerase chain reaction, hybrids, RAPD, mitotic recombination, genetic diversity, ITS-2. 1. Introduction 1.1 Schistosomiasis Schistosomiasis is endemic in counties where there is inadequate sanitation and no access to clean water resulting in 700 million people worldwide being at risk of infection and 207 million people already infected (World Health Organisation 2011). The leading cause is Schistosoma mansoni, a blood fluke that causes intestinal schistosomiasis. This parasite is found in Africa and South America where it is a serious health problem (Simoes et al. 2007). The disease can manifest with abdominal pain, diarrhoea, dysentry and in some severe cases cause hepatosplenomegaly which is enlargement of the liver and spleen (World Health Organisation 2011). The adult worms are found in the venules that surrond the intestine (Mann et al. 2009). It is the eggs in the tissues of the gut and deep body organs rather than the adult worms that cause of the pathology of the disease by releasing proteolytic enzymes which result in an inflammatory response (Clerinx and Gompel 2011). 1.2 Genetic diversity; transmission and epidemiology of S.mansoni The World Health Organisation (2011) have highlighted that schistosomiasis is now the second most important parasitic disease after malaria in terms of public health and economic impact, enhancing the severity of the problems that schistosomes can cause. Therefore, further research into methods which   will improve understanding of genetic variation of S. mansoni in the context of epidemiology and disease transmission in endemic areas (Durand et al. 2000). Considering the distribution of genetic diversity within the parasite population allows for a greater understand of the epidemiological factors which could influence the prevalence   of the disease (Thiele et al. 2008), especially with the concern of drug resistance and heterogeneity in virulence and pathology cause by different parasite population (Caillaud et al. 2006). 1.3 Drug resistance and vaccine development Praziquantel is commonly used to treat schistosomiasis and there is evidence to suggest resistance is becoming apparent (Ismail et al. 1999). The presence of non-synonymous mutations can affect the binding sites of drugs because these mutations are able to cause structural alterations in proteins causing drug resistance (Simoes et al. 2007). For this reason Berquist et al. (2002) suggest that a vaccine is needed against schistosomiasis as contemporary drugs such as praziquantel do not halt the transmission of the infection or stop re-infection from occurring. Due to the variability of antigens, studying the range of epitopes across the S. mansoni population is vital to vaccine development (Curtis and Minchella 2000). 1.4 Mitotic recombination in the S. mansoni life cycle causing genetic variation During the life cycle of S. mansoni (Figure 1) the miracidium infect Biomphalaria snails which act as the intermediate host which produce cercariae, humans are infected when cercariae penetrate the skin (Gryseels et al. 2006). Recombination occurs at a much lower frequency in mitosis than meiosis and is usually a rare occurrence (Archetti 2003). However, genetic diversity within the population of S. mansoni is caused by mitotic recombination during the asexual stage of the cycle (Bayne and Grevelding 2003). Grevelding (1999) also showed that the heterogeneity found among clonal cercariae all coming from a single miracidium infection, was a result of mitotic recombination events within the snail host during sporocystogenesis.   Mitosis should usually cause a single genotype, however, mitotic recombination is thought to be the cause of genetic diversity because of the presence of multiple genotypes. Figure 1 – The life cycle of Schistosoma mansoni In contrast, Sire et al. (1999) suggest that genetic diversity is greatly reduced when there is a single miracidium infection, this is justified in the study as they found that 88.4% of the snails produced single – parasite genotypes when infected with a single miracidium. However, they also found that a smaller amount of snails harboured multiple genotypes, evidential of mitotic recombination occurring. 1.5 Studying the genetic diversity of S.mansoni using molecular techniques Gower et al. (2007) suggested that a relevant problem in the in molecular studies of schistosomes is that adult worms are not easily available to study due to where they are found in the human body as they are in blood vessels that surround the intestine. Therefore, most studies involve infecting snails and using the cercariae to either infect laboratory mammals in order to extract the adult worms, or using the cercariae for their DNA and then conducting molecular studies (Gower et al. 2007). Molecular markers can be used to assess the genetic diversity by identifying parasite genotypes that have been collected from snail hosts (Dabo et al. 2007) Random amplified polymorphic DNA markers use oligonucleotides as primers to amplify DNA fragments (Lynch et al. 1994) . Sire et al. (1999) studied the genetic diversity and the distribution pattern of S.mansoni genotypes using RAPD markers and found that there were different genotypes of the parasite, 49 in total. RAPD markers are seen to be advantageous due to several factors such as quick analysis, but a major advantage is that they are able to detect numerous sequences in the DNA (Barral et al. 1996). RAPD markers are also reproducible as it is possible to the same genotype from the same individual numerous times (Figure 2 – Gel picture for reproducible RAPDs). However, an issue with using RAPD markers is that usually only highlight dominant genes (Barral et al. 1996). As they are also random a limitation is that it is not possible to know exactly where in the sequence that marker has attached itself to. Restriction fragment length polymorphisms can also be used to analyse DNA sequence differences in S.mansoni, highlighting the genetic diversity within the parasite population (Rodrigues 2002). By using other molecular markers that are highly polymorphic such as microsatellites, which are simple sequences of tandem repeated DNA (Chambers and MacAvoy 2000), the genetic diversity of S.mansoni between different hosts can be studied (Durand et al. 1995).   Gower et al. (2007) also suggest that the use of multi-locus microsatellites to highlight the genetic variation of schistosome larvae will enhance the knowledge about what is known of the epidemiology of the parasite. In this study RAPD markers were used to assess the genetic diversity of cercariae from a single miracidium infection, 10 female and 10 male S. mansoni and S. rodhaini hybrids. ITS – 2 primers were also used to discover if there was any genetic diversity amongst the second internal transcribed region of the ribosomal gene complex. The use of RAPD primers in this study should be able to show that mitotic recombination is happening within the asexual stage of the life cycle. The hypothesis of this study is to show that through the use of RAPD and ITS-2 primers mitotic recombination is occurring within the asexual stage of the schistosome life cycle. 2. Materials and Methods   2.1 Bioinformatics – RAPD primers Bioinformatic analysis was performed on 5 different RAPD primers (Table 1) to show that the primers attach themselves to random parts of the DNA sequence. The scaffold, the position in the scaffold and the features marking that part of the sequence were noted. This gave a complete genome perspective by ensuring that the primers were not binding to specific gene types or to a single region of the genome. Table   1. RAPD markers and the sequences they attach themselves to. RAPD primer Sequence OP- A9 GGGTAACGCC OP- A13 CAGCACCCAC OP G13 CTCTCCGCCA OP- A10 GTGATCGCAG OP B6 TGCTCTGCC 2.2 Comparison of DNA extraction methods: Beltran et al. (2008) and DNeasy protocol For the first DNA extractions a number of snails, Biomphalaria glabrata were infected with a single miracidium infection. In total 12 snails were infected for this experiment and 32 cercariae were collected from each snail. The DNA extraction method used on the cercariae was proposed by Beltran et al. (2008). For the DNA extraction 8 cercariae from a single snail which were each isolated   in 5 µl of purified water and then transferred to an eppendorf tube. 20 µl of NaOH (250mM) was then added to each tube and this was incubated for 15 minutes at 25 ºC. The samples were then heat shocked at 99 ºC for 2 minutes. The next step taken was to add 10 µl HCl (250mM), 5 µl   of Tris – HCl (500mM) and 5 µl   of Triton X – 100 ºC (2%) and this was again heat shocked at 99 ºC for 2 minutes. The samples were then stored at 20 ºC ready for PCR to be performed. The second method for the DNA extraction used a DNeasy protocol to extract the DNA from 20 schistosome hybrids. The hybrids used were produced from mono miracidial infections of Biomphalaria with female S.mansoni from Egypt and male S.rodhaini from Burundi from a previous experiment performed by Dr Scott Lawton. Firstly, 200 µl of AL was added to each of the schistosomehybrid DNA samples and was mixed by vortexing, following this 200 µl of ethanol was then added to each sample before vortexing again. This mixture was then placed into a DNeasy Mini spin column 2ml collection tube and centrifuged at 8000rpm for 1 minute. The DNeasy mini spin column was then placed into a new 2ml collection tube, 500 µl of buffer AW1 was added and it was again centrifuged for 1 minute at 8000rpm and again the DNeasy mini spin column was placed into a new 2ml collection tube. 500 µl of buffer AW2 was then added and was centrifuged for 3 minutes at 14 000rpm. The DNeasy column was then placed into a microcentrifuge tube and 200 µl of AE was added directly onto the DNeasy membrane, incubated at room temperature for 1 minutes and then then centrifuged at 8000rpm for 1 minute. 2.3 Amplification of cercariae and Schistosome hybrid DNA by Polymerase chain reaction (PCR) using RAPD primers PCR was performed using five primers described previously (Table 1); OP A9, OP A10, OP A13, OP G13 and OP B6. 2.5 µl of each DNA sample, 2 µl of each of the 5 different primers and 12.5 µl of PCR master mix containing Taq DNA Polymerase were added into separate PCR tubes. The DNA samples were firstly heated to 95 ºC for 15 minutes, then subjected to 40 cycles of 95 ºC for 1 minute followed by single cycles of 47 ºC for 1 minute and 72 ºC for 2 minutes. There was then a final elongation stage of 72 ºC for 10 minutes and then finally run to 4 ºC 2.4 Analysis of RAPD PCR products All PCR products were analysed using agarose gel electrophoresis was used to separate the DNA. 1% agarose gel was used in TAE and   8 µl of GelRed 10 000X in water (Biotium) was added to the gel. 5 µl   of each DNA sample was mixed with loading dye and placed into each separate well in the gel. A ladder was placed along side the DNA samples using a Bioline Hyperladder 1 ranging from 200bp to 10 000bp. The gel rack was then connected to the power supply and was allowed to run for 40 minutes. This gel was then visualised using a gel doc system. 2.5 Amplification of schistosome hybrid DNA by polymerase chain reaction (PCR) using ITS-2 primers and the analysis of the PCR products For the PCR using ITS-2 primers, 2 primers were added to each DNA sample from 5 female and 5 male schistosome hybrids, ITS-F (GGTACCGGTGGATCACGTGGTG) and ITS-R (CCTGGTTAGTTTCTTTTCCTCCGC). 2.5 µl of each DNA sample was added to a separate PCR tube, to this 12.5 µl of   PCR master mix (Thermo-Scientific) containing Taq DNA Polymerase, 5.0 µl of ITS-F and 5.0 µl of ITS-R was also added to each separate PCR tube. The PCR was then run at 95 ºC for 15 minutes, followed by 40 cycles at 95 ºC for 1 minute. The samples were then subjected to single cycles of 52 ºC for 1 minute and 72 ºC for 2 minutes and there was a final elongation stage at 72 ºC for 10 minutes before being run at 4 ºC. The PCR products were then run agarose gel electrophoresis using the same method used for the RAPD primers and the gel was visualised using a gel doc system. Sequencing of the ITS -2 regions was unsuccesful and therefore sequencing generated by Steinauer et al. (2008) were analysed to access if any mixing of the parental genotypes had occurred by identifying differences in single nucleotide polymorphisms within the F1 offspring. Sequences were downloaded from NCBI and aligned using clustalW2 (ebi.ac.uk/Tools/msa/clustalw2/). Alignments were then visualised using BioEdit to visualise nucleotide differences between the sequences. 3. Results 3.1 Bioinformatics – RAPD primers   BLAST searches on the RAPD primers showed that some of the sequences that the primers attached themselves to coded for proteins whilst others did not, highlighting that they are random (Lynch and Milligan 1994). Primers appear to bind to [rachel da1]  the different parts of the DNA sequence, for instance part of the sequence which codes for a specific protein and features marking that part of the sequence are shown. Where there is no feature it means that the sequence is a non-coding region (Table 2). Table 2. BLAST analysis on the RAPD primers 3.2 PCR products from the amplification of DNA from cercariae using RAPD markers Using the DNA extraction method suggested by Beltran et al. (2008) no PCR products were present on the gel when agarose gel electrophoresis was used (Figure 2). This method was therefore no longer used and the DNeasy kit was employed.    Figure 2. Gel picture showing that no DNA was present. 3.3 PCR products from the amplification of DNA from schistosome hybrids using RAPD markers RAPD PCR products from 10 female and 10 male schistosome hybrids were indicative that there were 4 genotypes found in the female DNA; A, B, C and D and 2 in the male DNA; E and F (Figure 3). However, genotypes D and F are the same, one being in the female population and one in the male showing that they are not sex specific. Figure 3. Showing 5 different genotypes in the schistosome hybrids. Genotype A: 1, 2, 4, 5, 6. Genotype B: 3. Genotype C: 10. Genotype D: 7, 8, 9. Genotype E: 11, 14, 17,18,20. Genotype F: 12, 13, 15, 16, 19. Table 3 shows the different sizes of each of the bands present for each genotype. Table 3. The size of bands present in each genotype 1000bp 800bp 600bp 200bp Genotype A * * * Genotype B * * * * Genotype C * * ** Genotype D * * * Genotype E * * Genotype F * * * *Band present **Double band present 3.4 PCR products from the amplification of DNA from schistosome hybrids using ITS -2 primers Double banding patterns were seen in the ITS – 2 PCR fragments, this is unexpected as the PCR should have produced a single discrete band (Figure 4). Figure 4.   Bands are present at 400bp and 200bp in both the male and female schistosome hybrids. It was not possible to sequence the ITS-2 region and so published data was used and analysed as described previously. Clear mixing of the parental genotypes can be seen (Table 4). For each SNP position mixing can be seen in the offspring with some nucleotides being from the S. mansoni parent and some from the S. rodhaini parent. [rachel da2] Table 4. Single nucleotide polymorphisms betweeen the parent species of Schistosoma mansoni (yellow) and Schistosoma rodhaini (red) and the resultant F1 offspring for published data on the ITS-1 marker. The SNPs appear not to exist as alleles and clear mixing of the parental genotypes can be seen in the offspring. SNP position 97 224 284 419 589 882 941 Species and Isolate                      (AF53134) S. mansoni A C T G C T A (AY446078) S. rodhaini G T C A G C G EU599378 G T T A G ? ? EU599377 A C T G G ? ? EU599376 A T C A G ? ? EU599375 A T C G G ? ? EU599374 A C T A G ? ? EU599373 A C C G G ? ? EU599372 A C C A G ? ? EU599371 A T T G G ? ? EU599370 G C C A G ? ? EU599369 G C C G G ? ? EU599368 G C T A G ? ? EU599367 G C T G G ? ? EU599366 G T C A G ? ? EU599365 G T C G G ? ? EU599364 G T T G G ? ? AF531313 G T C A C C G 4. Discussion 4.1 DNA extraction In this study a DNA extraction method suggested by Beltan et al. (2009) was used. An attempt at extracting DNA from 8 cercariae from a single miracidial infection of a snail and 20 Schistosome hybrids was performed and even though this DNA extraction method was said to be advantageous using small amounts of DNA , no bands were found to be present for RAPD or ITS-2 markers. Beltran et al. (2008) showed that from 10 cercariae the method was 98% and 100% successful in first and second amplifications retrospectively, however the results of this study indicate no DNA to be present suggesting that the protocol was not as 100% efficient as suggested. It could be that Beltran et al. (2008) analysed the DNA without using gel electrophoresis and other methods of analysing DNA[rachel da3]   were more suitable for this DNA extraction. However, it could also be the case that there were no cercariae to extract DNA from but this is unlikely as the cercariae were collected for the purposes of this study.[rachel da4] Alternatively, the DNeasy protocol used to extract the DNA from the adult hybrid worms proved to be more effective. Beltran et al. (2008) suggested that other methods of DNA extraction took time and were far more complex and even though this may be the case, the longer DNeasy protocol was far more effective at yielding DNA for this study. 4.2 Evidence of mitotic recombination in Schistosomes From a single miracidial infection of F1 hybrids, 6 genotypes have been produced supporting the theory by Bayne and Grevelding et al. (2003) that mitotic recombination is occurring in the asexual stage of the parasites life cycle within Biomphalaria snails. Although Sire et al. (1999) strongly suggested that genetic diversity was greatly reduced[rachel da5]   when there is a single miracidium infection the evidence from this study shows this to be incorrect due to the numerous genotypes observed. Multiple genotypes were seen in F1 generation produced from single miracidial infection which is indicative of recombination events. Recombination normally only happens during meiosis, however, this would not have had the opportunity to happen in the F1 thus recombination must have taken place during the asexual stage of of the life cycle. Hybrid breakdown occurs when the genetics that control physiology and development breakdown (Burton 1990) because of two gene pools and so two different sets of chromosomes mixing (Dobzhansky 1950). Therefore, a consequence of this hybrid breakdown could be mitotic recombination occurring and causing increased genetic diversity within the schistosome population. S. mansoni and S. rodhaini hybrids occur naturally (Morgan et al. 2003), and so it may be questionable   whether there are any pure species of schistosomes due to this naturally occuring hybridisation. Consequently if this hybridisation is occurring naturally all the time then increased genetic diversity within a schistosome population would be present. The host Biomphalaria snails only have an innate immune system (Minchella 1984). Therefore, if the parasite population has a high diversity of different genotypes the snail would not recognise them all as antigens allowing some strains to survive and so mitotic recombination could be a mechanism by which diversity arises in order for the parasite to evade the snail immune system (Caillaud et al. 2006). Sire et al. (1999) suggest that genetic diversity may be seen if there is higher productivity of snail hosts, due to an increased number of snails dying in response to a heavy parasite burden. Therefore, the different genotypes of the snail host that the parasite would be in contact with could affect the genetic diversity of the parasite. It is also suggested that if there is increased movement of the intermediate host, the Biomphalaria snail, it would encounter various different parasite genotypes from   other snail hosts (Sire et al. 1999). Therefore genetic diversity within schist osomes would be present. In this study mitotic recombination has caused greater genetic diversity in the female   parasite. This is vital for reproduction as it is the female that produces eggs (Clough 1981) therefore if more female genotypes able to evade the snail immune system and survive it means an increase in reproduction. The Red Queen Hypothesis is a co-evolutionary hypothesis suggesting that as the Biomphalaria snail host genes evolve the genes of the parasite that allow infectivity of the host will evolve alongside them (Van Valen 1973). Therefore, it could be this evolution of the parasite genes (Figure 6) affecting the ability of the schistosome population to infect the snail host which causes the genetic diversity (Carius et al. 2001). Figure 6. Red Queen Hypothesis showing the co-evolution of the snail host and the parasite. 4.3 The use of RAPD and rDNA markers in emphasising genetic diversity within schistosomes In this study the use of RAPD markers have been successful in highlighting the different genotypes present amongst S.mansoni and S.rodhaini hybrids. RAPD markers are therefore successful at allowing for genetic diversity to be quantified (Langand et al. 1999). RAPD markers have enabled the quantification of the different genotypes of the schistosome hybrids in this study and this is supported by Barral et al. (1996) who concluded that RAPD markers were efficient at providing a way of displaying genetic diversity within a schistosome population. Using reproducible RAPD markers is advantageous as it validates the results of this experiment as if the experiment was repeated the same results would be produced. If after repeating, the same results were found as reproducible RAPD markers were used it would further conclude that genetic diversity is definitely present in schistosome population. For the schistosome hybrids two ITS-2 bands were present on the gel and the reason for this is unclear. It could be due to lack of specific species barriers this second band has appeared. It could also be due to priming on another site, such as a viral or transposable element which has similarities to ITS-2 has inserted itself into the genome and how shown up on the gel as a second ITS band. Although it was not possible to sequence the ITS – 2 region, the sequencing generated by Steinauer et al. (2008) showed that there was genetic diversity within the F1 offspring. This genetic variation could also be caused by mitotic recombination happening within the asexual stage of the life cycle. References Archetti, M. (2003) A selfish origin for recombination. Journal of Theoretical Biology,  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   223(3), 335-346. Barral, V., Morand, S., Pointier, J.P., and Theron, A. (1996) Distribution of schistosome genetic diversity within naturally infected Rattus rattus detected by RAPD markers. Parasitology, 113(6), 511 – 517. Bayne, C.J., and Grevelding, C.G. (2003) Cloning of Schistosoma mansoni sporocysts in vitro and detection of genetic heterogeneity among individuals   within  Ã‚  Ã‚  Ã‚   clones. The Journal of Parasitology, 89(5), 1056-1060. Beltran, S., Galinier, R., Allienne, J., and Boissier, J. (2008) Cheap, rapid and  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  efficient DNA extraction method to perform multilocus microsatellite genotyping on all Schistosoma mansoni stages. Memà ³rias do Instituto   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Oswaldo Cruz, 103(5), 501-503. Berquist, R., Al-Sherbiny, M., Barakat, R., and Olds, R. (2002) Blueprint for schistosomiasis vaccine development. Acta tropica, 82(2), 183 – 192. Burton, R.S. (1990) Hybrid breakdown in developmental time in the copepod Tigriopus californicus. Evolution, 44(7), 1814 – 1822. Caillaud, D., Prugnolle, F., Durand, P., Theron, A. and de Meeus, T. (2006) Host sex and parasite genetic diversity. Microbes and Infection, 8(9-10), 2477 – 2483. Carius, H.J., Little, T.J. and Ebert, D. (2001) Genetic variation in host-parasite association: potential for coevolution and frequency-dependent selection. Evolution 55(6), 1136-1145. Chambers, G.K., and MacAvoy, E.S. (2000) Microsatellites: Consensus and controversy. Comparitive Biochemistry and Physiology, 126(4), 455 – 476. Clerinx, J., and Van Gompel, A. (2011) Schistosomiasis in travellers and migrants. Travel Medicine and Infections Disease, 9(1), 6-24. Clough, E.R. (1981) Morphology of Reproductive Organs and Oogenesis in Bisexual and Unisexual Transplants of Mature Schistosoma mansoni Females. The Journal of Parasitology, 67(4), 535-539. Curtis, J., and Minchella, D.J. (2000) Schistosome Population Genetic Structure: When Clumping Worms is not just splitting hairs. Parasitology Today, 16(2), 68-71. Dabo, A., Durand, P., Morand, S., Diakite, M., Langand, J., Imbert-Establet, D., Doumbo, O., and Jourdane, J. (1997) Distribution and genetic diversity of Schistosoma haematobium within its bulinid intermediate hosts in Mali. Acta Tropica, 66 (1), 15-26. Dobzhansky, T. (1950) Genetics of natural populations. XIX. Origin of heterosis through natural selection in populations of Drosophila pseudoobscura. Genetics 35(3), 288 – 302. Durand, P., Sire, C., and Theron, A. (2000) Isolation of microsatellite markers in the digenetic trematode Schistosoma mansoni from guadeloupe island. Molecular Ecology, 9(7), 997-998. Dybdahl, M.F. And Storfer, A. (2003) Parasite local adaptation: Red Queen versus Suicide King. Trends in ecology and evolution 18(10), 523-530. Gower, C.M., Shrivastava, J., Lamberton, P.H.L., Rollinson, D., Webster, B.L., Emery, A., Kabatereine, N.B., and Webster, J.P. (2007) Development and application of an ethically and epidemiologically advantageous assay for the multi-locus microsatellite analysis of Schistosoma mansoni. Parasitology, 134(4), 523-536. Grevelding, C. G. (1999) Genomic instability in Schistosoma mansoni. Molecular and Biochemical Parasitology, 101(1-2), 207-216. Gryseels, B., Polman, K., Clerinx, J., and Kestens, L. (2000) Human schistosomiasis. The Lancet, 368(9541), 1106-1118. Ismail, M., Botros, S., Metwally, A., William, S., Farghally, A., Tao, L. F., Day, T.A., and Bennett, J.L. (1999) Resistance to praziquantel: Direct evidence from Schistosoma mansoni isolated from egyptian villagers. The American Journal of Tropical Medicine and Hygiene, 60(6), 932-935. Langand, J., Theron, A., Pointier, J.P., Delay, B., and Jourdane, J. (1999) Population structure of Biomphalaria Glabrata, intermediate snail host of Schistosoma mansoni in Guadeloupe Island using RAPD markers. Journal of Molluscan Studies, 65(4), 425-433. Lynch, M., and Milligan B.G. (2004) Analysis of population genetic structure with RAPD markers. Molecular Ecology, 3(2), 91-99. Mann, V.H., Morales, M.E., Rinaldi, G., and Brindley, P.J. (2009) Culture for genetic manipulation of developmental stages of Schistosoma mansoni. Parasitology, 137(3), 451-462. Minchella, D.J. (1984) Host life-history variation in response to parasitism. Parasitology, 90(1), 205-216. Morgan, J.A.T., DeJong, R.J., Lwambo, N.J.S., Mungai, B.N., Mkoji, G.M. and Loker, E.S. (2003) First report of a natural hybrid between Schistosoma mansoni and S. rodhaini. The Journal of Parasitology, 89(2), 416-418. Rodrigues, N., Coura Filho, P., De Souza, C., Jannoti Passos, L., Dias-Neto, E., and Romanha, A. (2002) Populational structure of Schistosoma mansoni assessed by DNA microsatellites. International Journal for Parasitology, 32(7), 843-851. Simoes, M., Bahia, D., Zerlotini, A., Torres, K., Artiguenave, F., Neshich, G., Kuser, P., and Oliveira, G. (2007) Single nucleotide polymorphisms identification in expressed genes of Schistosoma mansoni. Molecular and Biochemical Parasitology, 154(2), 134-140. Sire, C., Durand, P., Pointier, J. P., and Thà ©ron, A. (1999) Genetic diversity and recruitment pattern of schistosoma mansoni in a Biomphalaria glabrata snail population: A field study using random-amplified polymorphic DNA markers. The Journal of Parasitology, 85(3), 436-441.

How To Write An Essay About Perfect Boss, with Outline

How To Write An Essay About Perfect Boss, with Outline How to Write an Essay about Perfect Boss (Writing Guide) How to start an essay about perfect boss How to write thesis for an essay  about perfect boss How to write body pargraphs for an essay about perfect boss How to conclude an essay about  perfect boss Outline example Topic Actuality Essay writing takes into consideration a few basics that make a paper stand out. In this case, the topic to focus on is The Perfect Boss. It deals with the characteristics typically associated with a perfect boss that is, an employees superior at the place of work. It elaborates on the behaviors of a boss whom an employee or junior person can want to emulate. A boss is someone who portrays power and influence. The topic and general paper should paint or portray this fact effectively. How to Start an Essay about Perfect Boss To write an essay about a perfect boss, one will follow a few steps. The author will first define what a boss is. There are different types of bosses at different places of work. The definition has to capture the fact that a boss mainly relates to the place of work. The introduction should also clarify that no boss is perfect, just as no human being is perfect. All employers have faults. However, a perfect boss is one who meets most of the expected behaviors of a good manager or employer. The expectations are to be pointed out in the subsequent paragraphs. How to Write Thesis for an Essay about Perfect Boss Given that the topic is already identified and the extent of the content determined, the next thing one has to do is identify and clearly point out the thesis statement. A thesis statement, the last sentence found in the introductory paragraph, is a short statement that illustrates the position that the writer intends to pass across. The thesis statement should give the reader a hint about the characteristics of a perfect boss. For instance, the thesis statement should summarize the main features of a perfect boss such as honesty, being a role model for employees, hardworking, understanding, smart, among others. Alternatively, the thesis statement can also highlight the summary of what a perfect boss should be. For instance, it can read, a perfect boss will not only be hard working, strict, and act as a role model to employees, but will also show deep and sincere concern for employees. How to Write Body Paragraphs for an Essay about Perfect Boss The body of the essay is to be about three paragraphs. The first paragraph will enumerate a few examples of bosses who have been acknowledged by employees as perfect bosses. Examples should be drawn from a variety of sources, industries, and sectors. For instance, the essay will mention globally recognized and feted managers and directors. Typical examples of perfect bosses to be emphasized include Mark Zuckerberg, the Chief Executive Officer of Facebook, among many others. The first paragraph can also recognize less known, but revolutionary individuals who have played a leading role in the success of their industries and sectors through role modeling. The second paragraph should elaborate the fact that a boss is a manager hence his or her management style determines whether or not he becomes a perfect boss. It will draw attention to the main features of an employer or manager who can be considered a perfect boss. Some of the key features to be pointed out include leadership by example, where the boss sets high ethical standards and follows established rules and norms, and motivates employees to follow the same rule. At this point, the essay should point out how the leaders behavior and that of employees relate. Another characteristic can include effective communication. The writer should elaborate that an effective boss communicates in a timely and clear manner. Transparency, valuing employees, deep knowledge, respect, and sensitivity are other aspects that can be discussed in detail. The essay should also accentuate that a perfect boss recognizes the effort and makes the employees feel appreciated. Positive reinforcement works well on employees and encourages them to continue with good performance.   The fact that a perfect boss gives feedback should also be underscored. In this regard, the essay should state that feedback should be prompt and should be given with a positive attitude. It should be encouraging, and meant to correct rather than rebuke. A great boss, the essay should note, has to sit down with employees and discuss with them. Then he or she has to set clear expectations and motivate employees to attain the expectations. The third paragraph can highlight how the relationship between employees and their boss directly affects the performance of an organization. It will also state the fact that perfect bosses are loved by employees, they are self-motivated, and they yield results. The last part of the third paragraph will explain that a perfect boss inspires other bosses or managers at similar or higher levels to emulate him or her. How to conclude an essay about perfect boss A perfect essay is one with a short but clear conclusion that reiterates the features of a perfect boss. The concluding paragraph will also note the link between the performance of an organization and the management style. Outline Sample Introduction What is a perfect boss? Thesis statement   Nobody is perfect Body Examples of perfect bosses Effect of management styles Features of perfect bosses Impact of the relationship between employees and bosses on performance Conclusion Reiteration of main ideas

To what extent was the Cold War global in nature Essay

To what extent was the Cold War global in nature - Essay Example First is the issue of spheres of influence. Spheres of influence have usually offered a tactic of control against immense power struggles by, establishing a defence ring of geographic territories around the lands of superpowers (Feste 1992). Certainly, throughout the Cold War the great powers formulated ideals concerning spheres of influence that were somewhat vital. In the initial stages of fierce Cold War struggle, the fight between the Soviet Union and the United States ensued over concerns of the external and internal direction of European countries, which is quite localized in nature. Yet, the regime supported by each of the great power appeared to create â€Å"a credible philosophical and organisational substitute for the old order of European politics† (Feste 1992, 15). The struggle hence becomes globalised. When the aforementioned part of the struggle weakened due to the military standoff and the recovery of Europe, the emphasis of the conflict moved to the developing or colonial nations. At this point, dissimilar from the European condition, the struggle between the Soviet Union and the United States seldom involved political or military domination (Westad 2005). More importantly, it involved the demands of the particular political and social paradigms introduced by the Soviet Union and the United States to the emerging countries. This struggle between the great powers had a major global impact on political reforms in developing and underdeveloped countries. Among other things, it increased the emphasis on social change, on economic progress, and nation building, which the Soviet Union and the United States recognised as the core rationale for these nations in their affairs with either of the great powers (Feste 1992). The global nature of the Cold War, in relation to this great power conflict, is precisely described by Paul Seabury (as cited in Feste 1992,16): Classical great-power competition had stressed principally the respective force capab ilities of states: their command of military power; their ability to build, sustain and manipulate alliances; the reach of their economic and commercial influence. Yet, Soviet-American competition added to this a further element: since both systems claimed to be based upon and legitimated by certain universally valid socioeconomic principles, so their respective performances were then to be judged by supposedly universal norms. The touchstone of performance was thus not merely to be seen in direct matters of power and effective influence when both systems impinged on each other, but in the operational vitality of the principles themselves, both within and outside their respective national and hegemonic realms. Hence the strength of American supremacy stemmed from specific normative ideals not simply assessed in terms of domestic influence and authority. Furthermore, ideology was indispensable as well for the Soviet Union to preserve its position globally, which necessitated support for radical campaigns (Westad 2005). The Cold War had created a particular cluster of organised, global interconnections that held an impression of order and formed a new world balance (Westad 2005). These circumstances depended on a unified group of principles that offered a justification for the interferences of the great powers throughout the Cold War period. Aside from the sphere of influence factor, strategic geographical positioning and ideology made the Cold War a global affair. William Bundy (1989) describes the global nature of the Cold War in terms of ‘balance of power’, arguing that it is difficult to overstate the level of the global supremacy by the Soviet Union and the United States in the initial decades of the post-war period. In terms of

The Illusion of Taking Charge Term Paper Example | Topics and Well Written Essays - 750 words

The Illusion of Taking Charge - Term Paper Example The Fifth Discipline withstands this acid test. It has turned theoreticians into practical individuals. Spiritual bent in Senge’s writings is clearly seen. He gives lots of importance to the inner world of the individual, while explaining the limitations of materialists in chasing the secular goals. Learning organization means a progressive organization, a rebel against the traditional methods and willing to learn and move forward. It visualizes the threats well in time and makes use of the new opportunities. It knows value of the empowering approach. â€Å"In his prominent book, The Fifth Discipline, Senge identified some learning disabilities associated with the failure to think systemically. He classified them under the following headings: I am my position" "The enemy is out there" "The illusion of taking charge" "The fixation on events" "The parable of the boiled frog" "The delusion of learning from experience" (1990, pp. 17 - 26) I have been affected by the disability re lated to the illusion of taking charge: How I have been personally impacted by this disability. They say, tomorrow never comes, today it may be too late, do it just now. I am working for an export organization and the issue was about getting my passport ready, as instructed by my Export Manager. The Company has short-listed the names of certain employees and he told me that I was one from the Export Division of the company being considered for a study-tour of some Import Establishments in America. He told me to keep my passport and other papers ready. I presumed that the chance may not be forthcoming soon, and went on postponing my planned visit to the Passport Office. In fact, I had requested one of my friends staying near the Passport Office (the office is about 30 kilometers from our Organization) but did not pursue it effectively. My friend must have forgotten about my request. When, after a fortnight, my Export Manager, enquired about the passport for officially routing though the visa application, with a sorry face I had to tell him that I did not do anything about it. The issue was immediate and my two colleagues left for the foreign tour of three months. With the self-imposed denial of this opportunity, my chances of future promotion in the office were also affected. How the organization that I work for has has been impacted by this disability I believe my failure in this passport episode is my inability to think systematically. I should have acted, the very moment, that I got the information from my Export Manager, for getting the Passport ready. Though my Organization was not affected badly, to some extent its impact was there. I was specializing in export-related issues of the company and my two friends-colleagues who went to USA were not experts in that area, but the Management had to send some representatives. My negligence to carry out the instructions well in time came to the notice of the top management, and naturally they were not happy about it. Senge writes, â€Å"The illusion of taking charge being â€Å"proactive† is in vogue. Managers frequently proclaim the need for taking charge in facing difficult problems.†(p.20)Through this incident, I have experienced the truth of this statement. How was the disability overcome Senge writes, "Generative Learning cannot be sustained in an organization if people's thinking is dominated by short-term events. If we focus on events, the best we can ever do is predict an event before it happens so that we can react optimally. But we

Sex trafficking in the United states and if the women involved should Research Proposal

Sex trafficking in the United states and if the women involved should be prosecuted or considered victims - Research Proposal Example any of the women that are in the sex trafficking industry are targeted by pimps or recruiters because they seem to be in desperate situations such as being homeless or addicted to drugs, most of the women are suffering from extreme poverty. Once the women are brought into sex trafficking the recruiters have various methods of forcing them to continue. These can include physical violence, threats of violence to family members, threats of exposure and restricting the women’s freedom. (Raymond, Hughes. 7-8) The women that are forced into this life style are most often victims and should not be criminally prosecuted. Some of the women that are involved in sex trafficking do so willingly, mostly in the form of prostitution. One reason that many people oppose this form of sex trafficking is because they feel that it is morally wrong and the women are harmed by doing so (Dempsey. 18) Criminal prosecution of the women that willingly become prostitutes may deter others from becoming prostitutes, it would do nothing to stop unscrupulous people from forcing women into the

Wal-Marts shift to Radio Frequency Identification Essay

Wal-Marts shift to Radio Frequency Identification - Essay Example With money, people could easily purchase exactly what they wanted or needed. This continued on for a few centuries and is still in use in the world though not in the same sense as it used to be before. Today science and technology have revolutionized each and every aspect of human life. Shopping and business are no exceptions-they too have been profoundly modified by technology. Credit cards, billing systems, shopping on the web, internet bank accounts and the system of barcodes on products are some of the examples that depict the extent to which technology has penetrated into this frontier. Even though many advances have been made, global concerns are growing regarding aspects like shoplifting, piracy and misappropriation of products. To check these many solutions have been proposed like the bar code system and most recently the RFID technology. This technology has both merits and demerits as does every other technology ever conceived. Wal Mart's decision to make use of it has given it an impetus. This essay describes about the prospects and aspects of RFID technology keeping Wal Mart in the background. RFID, an emerging technology, stands for Radio Frequency Identification. ...An RFID tag is a small object, such as an adhesive sticker, that can be attached to or incorporated into a product, animal, or person. RFID tags contain antennas to enable them to receive and respond to radio-frequency queries from an RFID transceiver. Passive tags require no internal power source." The tags are generally miniaturized electronic circuits enclosed in protective cases. When they absorb signal from a reading device they get activated and send out data to the reading device. When an RFID tag passes through the electromagnetic zone, it detects the reader's activation signal. The reader decodes the data encoded in the tag's integrated circuit (silicon chip) and the data is passed to the host computer for processing(RFID: From Wikipedia, the free encyclopedia 2005). In this way details like its location etc can be ascertained by the reading device. Based on power consumption tags are classified as active or passive. Passive RFID tags have no internal power supply. They do not contain any batteries inside them. The minute electrical current induced in the antenna by the incoming radio frequency signal provides just enough power for the tag to transmit a response. Lack of an onboard power supply means that the device can be quite small and light weight: commercially available products exist that can be embedded into many products. As of 2005, the smallest such devices commercially available measured 0.4 mm 0.4 mm, which is thinner than a sheet of paper; such devices are practically invisible to the naked eye (RFID: From Wikipedia, the free encyclopedia 2005).

War in Syria Essay Example | Topics and Well Written Essays - 1500 words

War in Syria - Essay Example The uprising is believed to be caused by dictatorship, corruption and human rights violations among other grievances (Rosiny, 2). Syrian war is a prolonged conflict that is currently taking place in Syria between the military and those opposed to the regime of Baa’thist government led by Bashar al-Assad. It started during the Arab spring. Syrian Arab republic was established in 1920 as a French colony in Western Asia. It has its headquarters in Damascus. The country borders Israel, Turkey, Lebanon, Iraq and the Mediterranean Sea. At the time of the Arab spring Syrian president Bashar al Assad enjoyed a relatively good support from the citizens. Bashar al Assad took the reign of power from his father, Hafez al- Assad in 2000 when the father died. Hafez became president in 1970 through a coup de tat. After taking power, Hafez set up an authoritarian regime that didn’t tolerate activities of the Muslim brotherhood which was the main opposition to the ruling regime at that time. He encouraged the idea of divide and rule. He enjoyed the support of the Sunni Arabs who made up almost 60% of the entire Syrian population and that of Christians. He also had the support of his minority group of the Alawis. He excluded those who were perceived not to be in support of his policies like the Kurds. When his son took power in 2000, he introduced political and economical reform measures in Syria. He released scores of political prisoners and initiated a number of economic reforms that made him popular with the people. According to Assad Al-Saleh (2014), the period known as the Damascus spring which was during the earlier days of Bashar al- Assad tenure in office shows that the opposition and political activities were tolerated. But this did not last for long. Bashar al Assad regime was characterized by corruption and alienated other communities. The regime was also oppressive and arrested opposition leaders. The people

Wal-Marts shift to Radio Frequency Identification Essay

Wal-Marts shift to Radio Frequency Identification - Essay Example With money, people could easily purchase exactly what they wanted or needed. This continued on for a few centuries and is still in use in the world though not in the same sense as it used to be before. Today science and technology have revolutionized each and every aspect of human life. Shopping and business are no exceptions-they too have been profoundly modified by technology. Credit cards, billing systems, shopping on the web, internet bank accounts and the system of barcodes on products are some of the examples that depict the extent to which technology has penetrated into this frontier. Even though many advances have been made, global concerns are growing regarding aspects like shoplifting, piracy and misappropriation of products. To check these many solutions have been proposed like the bar code system and most recently the RFID technology. This technology has both merits and demerits as does every other technology ever conceived. Wal Mart's decision to make use of it has given it an impetus. This essay describes about the prospects and aspects of RFID technology keeping Wal Mart in the background. RFID, an emerging technology, stands for Radio Frequency Identification. ...An RFID tag is a small object, such as an adhesive sticker, that can be attached to or incorporated into a product, animal, or person. RFID tags contain antennas to enable them to receive and respond to radio-frequency queries from an RFID transceiver. Passive tags require no internal power source." The tags are generally miniaturized electronic circuits enclosed in protective cases. When they absorb signal from a reading device they get activated and send out data to the reading device. When an RFID tag passes through the electromagnetic zone, it detects the reader's activation signal. The reader decodes the data encoded in the tag's integrated circuit (silicon chip) and the data is passed to the host computer for processing(RFID: From Wikipedia, the free encyclopedia 2005). In this way details like its location etc can be ascertained by the reading device. Based on power consumption tags are classified as active or passive. Passive RFID tags have no internal power supply. They do not contain any batteries inside them. The minute electrical current induced in the antenna by the incoming radio frequency signal provides just enough power for the tag to transmit a response. Lack of an onboard power supply means that the device can be quite small and light weight: commercially available products exist that can be embedded into many products. As of 2005, the smallest such devices commercially available measured 0.4 mm 0.4 mm, which is thinner than a sheet of paper; such devices are practically invisible to the naked eye (RFID: From Wikipedia, the free encyclopedia 2005).

Why is terrorism difficult to define Essay Example | Topics and Well Written Essays - 500 words

Why is terrorism difficult to define - Essay Example Terrorism, as Oxford dictionary describes, is (1) "government by intimidation as directed and carried out by the party in power in France during the Revolution of 1789-94 . . . " and (2) "policy intended to strike with terror those against whom it is adopted." It is interesting to see that both definitions hold a common viewpoint for those people who resort to threats and violence that is outside the normal oppositional struggle against their enemies. Although this definition is easy to understand, if we look deeper we can find that this definition is vague. The question that this definition fails to answer is ‘How do we measure what extent of violence is considered ''outside the normal oppositional struggle'’? As we begin to understand this problem, we find that there is no objective criterion available to us to gauge what extent of violence and threat can be called as an act of 'terrorism'. This difficulty to find what qualifies as an act of terrorism is even more diff icult since ‘terror’ is used to describe a strategy rather than an act. The strategy is to send a message to the higher ups in the government that they and their policies are vulnerable, that there is common voice in the public that are against government’s policies and that public has the capacity to attack the government in case those policies aren’t removed. The most common type of terrorism in the world is religion related. Multitude organizations all over the globe fight to uphold their religion.

Water and Air Population Analysis Essay Example for Free

Water and Air Population Analysis Essay Despite the adverse effects associated with pollution of the environment, countries continue to pollute the air and water with chemicals, green gases, oil and other waste from domestic or industrial entities. The problem of pollution is a universal one, although different countries experience it at varying degrees. In my local community, (Kuwait) is an oil rich country, and is a major exporter of crude oil to US and other countries. Most people in Kuwait depend on oil for energy needs. The climatic and geographic conditions tend to be extreme most of the year. Temperatures can sore up to 510 during summer and drop to -20 during winters. The topography in Kuwait is mostly desert, with only one hill that stands at 300 meters tall. Only 9% of land in Kuwait lends to arable farming or forest growth. Given that Kuwait is an oil rich country with numerous oil mine points, its waters are prone to pollution due to the oil spills that occur regularly despite mitigation efforts employed by the country. In addition, oil reserves often catch fires, which emit allot of smoke causing a lot of pollution inn Kuwait. The situation is further compounded by the lack of forests or plants, which purify the air by seeping carbon dioxide from the oil fires. It takes long for the effects of oil smoke to be erased and the environment is often the victim. Beside the oil fires experienced in Kuwait, air pollution also occurs from domestic sector as well as enterprises that depend a lot on oil energy for production. The desert topography in Kuwait offers very little chance of natural cleansing to occur due to the absence of vegetation or rainforests and thus the air pollution directly affects the dessert and water pollution in Kuwait. It is rare to witness rain in Kuwait, but when it rains, the amount is massive. Water in Kuwait is a rare commodity because even the lakes and rainwater have become acidic and contaminated from the frequent oil spills and smoke from oil fires, which is a common problem. Besides, when it rains top soils are heavily eroded rendering water inconsumable. It seems to me that the climatic and topographical factors in Kuwait contribute very little if any, mechanism of reducing air and water pollution. This is because of the lack of fundamental components to reduce these pollutions say vegetation, land cover and so on. The two obvious victims of air and water pollution in Kuwait are the people in Kuwait and the environment. On a macro perspective, the human race is a victim of the pollution in Kuwait as seen in the destruction of the ozone layer and global warming. The economic impact on Kuwait citizens is that food production has become very expensive. Most food is imported from other countries. For the economically burdened, meeting this basic need is an everyday nightmare. Air borne diseases are also common among Kuwait people especially those who reside near oil lakes and wells. The impact of oil fires, particularly the Persian Gulf fire, is still felt in the economic spectrum of Kuwait. Over time, it has been reported that the oil reserves in Kuwait are sinking by the day thereby reducing the countries GDP. The reason behind this is not clear but perhaps pollution has a hand in it. Children, who are the most vulnerable group to air and water pollution in Kuwait, continue to suffer from respiratory disease due to poor quality air. The extreme temperatures experienced in Kuwait have been underpinned to destruction of the ozone layer due to the carbon emission from oils fires in Kuwait. The result has been wilting of crops in the few oases in Kuwait and solidification of lakes in Kuwait. The situation on air and water pollution is terrible in my community (Kuwait) but the government is keen to impose policies that will reduce the extent of air and water References Topography in Kuwait. Available at http://www. arab. net/kuwait/kt_topography. htm accessed on September 18, 2007

How did the Dada Artists Challenge the Contemporary Art?

How did the Dada Artists Challenge the Contemporary Art? This essay will dive into the world of dada by firstly exploring the movement with an in-depth look into the brief history of dada and the foundations of which it was built around, how it changed art Dada was not just an art movement but as much of an cultural movement, this revolutionary movement originated in Zurich, Switzerland in the early months of 1916 it was one of the shortest lived art movements and only survived less than 10years until 1924 Dadaism did not start off as an art movement it was born of more as a artistic protest that grew as a response to not only the carnage that was world war one but also to the destruction of society that was crumbling around them, as the war spiralled across Europe the majority of the artists who founded dada had witnessed the relentless slaughter of innocent men, women and children as undeniable proof that the nationalist authorities had failed society and was undeniably corrupt. With most of the Dadaists being directly affected by WW1 and fleeing from across Europe themselves to seek refuge in Switzerland as many people did with Switzerland being neutral within the wall it became a safe haven for a huge number of people including many artists and intellects who found sanctuary in Zurich, which was the birthplace of dada included in the refuges that escaped the destruction of the war where a young couple from Munich, Germany named Hugo Ball who was a former theatre director and his gi rlfriend Emily Hennings a dancer who also wrote her own poems and books not long after arriving they became the parents of dada when they convinced the owner of a nearby cafà © to let them rent a room from him to begin a cabaret club. They named their club Cabaret Voltaire (fig .1) after one of Frances greatest entitlement writers Francois- Marie Arount and commonly known as Voltaire he was a famous writer, historian, poet and philosopher but was most famous for his wit and his attacks on the roman catholic church with his advocacy of freedom of religion and speech you can see how the young couple related to his values and beliefs and used him as an advocate and inspiration in the laying of the foundations of dada. Cabaret Voltaire opened its doors February 5th 1916 with Hugo Ball sent out a press release that translated Cabaret Voltaire under this name a group of young artists and writers has formed with the objective of becoming a centre of artistic entertainment in principle, guest artist will come and give musical performances and readings at the daily meetings. Young artists of Zurich whatever their tendencies, are invited to come along with suggestions and contributions of all kinds and with this release the dada family was formed with a bunch of like-minded misfits who included Marcel Janco, Tristian Tarzara, Richard Huelsenbeck, Hans (jean) Arp, Sophie Taeuber, Kurt Schwitters, Marcel Duchamp and Joan Miro ( fig.2) all coming through the doors within the first couple nights of the club opening and they quickly bonded over not just society but art and they woes of the world surrounding them and how many in society did not know or care with the world surrounding them, this small group of people connected over art and the discretion of the world around it and became close friends spending most days and nights together discussing and practising their own politics, views and art. With the Cabaret Voltaire being run by this close group of friends it became a cross between a night club and arts centre while here artist could showcase their work in a whole new experimental environment, often playing around with music, dance, theatre, poetry, readings, photography and all photography and often experimenting with visual arts. while showcasing their art to the art society of Zurich they could discuss the world around them and the founders became united in their views and their protest the war, society and the establishment. Performances in the beginning were relatively conventional being true to a variety show but as WW1 grew so did the artists anger and wanting for change and realisation, part of the movement was a full-on strike on the art world which they saw as part of the system it was considered likewise accountable and therefore had to be overthrown. Dada questioned the value of all art and whether its existence was simply an indulgence of the middle and upper-class they confronted traditional artistic values with nonsensical and irrational attitudes and with these provoked conservative complacencies with outrageous statements and actions as within a couple of weeks the artists at Cabaret Voltaire were experimenting with shock tactics becoming increasingly unorthodox and rebellious with its art and as soon as the founders became aware that the crowds were drawn to this type of art and valued it they began to run with it they began to showcase their own politics and views and rebelled more and mor e against art, society and the war. Although the Dadaists were united in their ideals they had no unifying style, an between the short lived period of Dada group it attracted many different type of artists who were not willing to conform to societies standards of art which meant the artists could allow the movement to have so many diverse styles which allowed them to play with their art and grow with new styles and bring to life new art. The Cabaret Voltaire and its members pushed the boundaries that surrounded them in a very short lived time together at the Cabaret Voltaire as it was forced to closed their doors only six months after it opened due to the nightly antics of the huge crowds that were drawn to the club and the relaxed nature of the lease owners not paying rent. Marx and Mills Theories of Freedom: A Comparison Marx and Mills Theories of Freedom: A Comparison SANDRINE UWIMANA MARX AND MILL’S VIEWS ON FREEDOM. This essay compares and contrasts Karl Marx and J.S. Mill on their understandings of freedom and their analyses of the impediments to its realization. Both Marx and Mill agree that human beings are capable of making progress and that the concept of freedom is an end in itself. Thus, they saw freedom as a means to realise individual potential and self-determination. However, both differ on the concept of freedom realisation and the impediments to freedom. Mill argues that the impediment to freedom is the masculine society while Marx argues that the impediment to freedom is the bourgeoisie. Furthermore, the essay discusses the intervention by state/society into freedom. Mill assert that the society can interfere into someone’s freedom when there is harm done to others. For Mill freedom should be exercised as long as there is no harm done to others while Marx supports the freedom to overthrow the bourgeoisie . On the other hand, Marx views hold that the government/ society should intervene in individual freedom to avoid individuality that leads to private property and hence creating classes. Both Marx and Mill see freedom as an end in itself. According to Marx’s definition of freedom, was viewed as an end in itself. â€Å"Only in community has each individual the means of cultivating his gifts in all directions; only in the community, therefore, is personal freedom possible. In the previous substitutes for the community, in the State, etc. personal freedom has existed only for the individuals who developed within the relationships of the ruling class, and only insofar as they were individuals of this class,† Karl Marx and Frederick Engels. For Mill, freedom of speech, opinion and the right to associate with others, were important for the progress of mankind. Freedom of choice is and do what is desirable as long as no harm is done to others is an end in itself. As Mill thus say that , â€Å"†¦ though the customs be both good as customs†¦ yet to conform to custom†¦ does not†¦ develop†¦human faculties†¦exercised only in making a choice.† (Mill 60). It is evident that freedom of choice is important to the development of individuality and progress of the society as a whole. Thus, freedom is an end in itself, because utilizing human lead to make choices is beneficial for personal development. Hence, the view that sees freedom as an end in itself can be attributed to both Marx and Mill. On the other hand, there are considerable differences between Mill and Marx perspectives on views regarding freedom. For Mill, freedom is important for the purpose of searching for truth and for reasons to live and for progress ( Mill 29). Mill asserts that a man must be free to pursue his happiness and pleasure. Furthermore, Mill in â€Å"On Libertyâ€Å" asserts that individual freedom is the paramount chief for the progress of society. The opinion of the individual has to be nurtured and allowed to grow so that he can use his assets and talents to benefit the society at large ( Mill 63). Thus, Mill, can be summarised in On Liberty : The only freedom which deserves the name, is that of pursuing our own good in our own way, so long as we do not attempt to deprive others of theirs, or impede their efforts to obtain it. An individual has the capability and the power to be creative in a society that recognises that ability. As well, Mill argues for the freedom of speech for everyone and that each individual opinion should be respected regardless of its content. Mill also argues that freedom/liberty is important for the pursuit of happiness (Mill 29). However , Marx asserts that people should not be individualistic and should not pursue their own interests but should conform to the society’s norms. For example in â€Å"On The Jewish Question: Zur Judenfrage, â€Å" Marx criticizes the liberal concept of freedom and argues that it assumes that a human being is â€Å"an isolated monad† ( Max 364) who pursues his own private happiness and also tries to avoid conflict with others ( Marx 370). He argue that an individual cannot be treated separately from society. The individual is part and parcel of society and there is nowhere he/she is going to operate in isolation without affecting the society as a whole. Hence, Marx argues that the communist system would make it possible for everyone including children and women to be free as they would not be for ced to work for the anyone (Marx 72). For Marx, this is freedom. As well, Marx explains how â€Å"my free activity† transforms itself into â€Å"the alienated and inhumane power† with the fetishism of the commodity. (Marx, 554). Furthermore, Mill and Marx offer a different perspective on the intervention by state/society into freedom. Mill argues that there is no justification for interfering in other people’s opinions and thinking. Not even the government has the right to interfere in someone’s freedom. It could be argued that this is the foundation of modern individual freedom. You are free and entitled to your own opinions as long as you don’t harm another ( Mill 4). â€Å"The reason for not interfering, unless for the sake of others, with a persons voluntary acts, is consideration for his liberty. His voluntary choice is evidence that what he so chooses is desirable, or at least endurable, to him, and his good is on the whole best provided for him by allowing him to take his own means of pursuing it,† Mill (14). In contrast, Marx argues that there is a need for the state to interfere with private property so that property ownership might be abolished. The government should hav e the right and the means to control the people who have private property, thereby forming an ideal communist society. It has to be noted that Marx ‘s arguments were based on the view that capitalism was evil and hence needed to be replaced by communism. As well, Karl Marx, in On the Jewish Question says that None of the supposed rights of man go beyond the egoistic man, man as he is a member of civil society; that is, an individual separated from the community, withdrawn into himself, wholly preoccupied with his private interests and acting in accordance with his private caprice. Hence, a person has to conform to the society’s norms. Thus, Marx views counter-argue the view by Mill that the society should respect the individual freedom. On the other hand, Mill warns against the tranny of the majority because sometimes the majority’s opinion is not always right. Thus the protection of the individual is more important and have to be protected. In addition, Mill’s and Marx’ views differ on the exercise of freedom. According to Mill, freedom and liberty is having free will and self- determination without being subjected to invariable law ( Mill 32). Mill adds that innovation and creativity can be achieved in a free environment . Thus, he advocates for a free environment which allows for development and growth of new ideas. â€Å"Genius can only breathe freely in anatmosphereof freedom. Persons of genius are †¦moreindividual than any other people† ( Mill, 65). Thus, freedom of the individual will allow new ideas and result in the progress of the society as a whole. As well, he argues that the society or the state should not force people to conform to the particular norms of the society and nor intervene in the activities of the individual which contribute to the development of the community as a whole. However, Mill acknowledges that the only time when the government or the society has to interfere i s when it steps in to prevent your harming other people (Mill 68). Thus, Mill asserts that freedom should be exercised as long as there is no harm done to others. Mill, a man’s freedom has to be protected and allowed to be explored without infringing on other people’s freedom. Nevertheless, the exercising of freedom should be checked. In addition, Marx argues that the majority of the working class should fight for their freedom and overcome the tyranny of the bourgeoisie (Marx 73). This seems like the views of Mill who argues that the citizens are to have freedom and the state, which is in small minority, should not exercise tyranny over them. Mill, on the other hand, argues that the freedom to unite has to be done in such a way that there is not harm to others . Mill would see the argument of Marx advocating the overthrow and taking the property of the bourgeoisie as harm done to others. In the Manifesto, Marx calls for the freedom of the working class to unite and in the end to revolt against the production owners also known as Bourgeoisie (Marx Engels, 34). The working class will rise up for their freedom. Marx asserts that freedom can be achieved through ideology. If the working class would learn and know the ideology of the bourgeoisie, they would be able to develop a counter ideology and hence the proletari at would become self-conscious and self-aware and thus be able to manage and control the means of production (Marx 173.) Thus, Marx argues that the working class would be freed from alienated labour if they knew the ideology of the bourgeoisie. This is how the proletariat would be able to overcome the exploitation of the bourgeoisie. For Marx, the working class should be united and fight for their individual freedom . As well, according to Marx, freedom could be achieved if the working class owned the means of production. It can also be viewed that capitalist system dies freedom to the working class in the modern era. For example, even if you desire to have a certain type of work, you are not free to choose your boss. On the same point the people who controls the means of production have the freedom to choose among the abundance supply of labour. I would agree that communism in which the means of production is owned by many could have been a good society for mankind. Capitalism denies the freedom of choices to many people especially the poor. It lead to a few of individual controlling all the wealth. As well, I would argue that in the modern era, due to capitalism, most working class people do not have freedom. In the world of today, the owner of the means of production decides which work you are supposed to do but the working class person is not free to choose his work and set his own wages. This could be regarded as a lack of freedom as the working class do not have a choice but rather to work under the conditions set by the master. For Marx, the ideal society was communism that gave everyone a chance to own something and freedom to majority. As well, Marx argues that there is a need for society to interfere to help the individual realise his potential/ self-cultivation. This is so because Marx believes that the society should be classless. Marx asserts that classless society is the foundation of freedom for all because the working class will have power in the production of goods and commodities and hence hold the interest of everyone. When the bourgeois owns the means of production the majority of the people who are the working class are left out. Furthermore, Marx asserts that the impediment to freedom is the bourgeoisie. For instance, Marx argues that the bourgeoisie controls the means of production, robbing freedom from the working class by exploiting their labour. The different classes results in the working class being oppressed . The class of the bourgeoisie infringes upon the freedom of the working class in what he calls the â€Å" class struggle† to refer to a situation where one group has an advantage over the other group. This is so because the class that has an advantage will try and maintain its status quo and in so doing will establish norms that maintain that class. The working class person has no freedom in the capitalist world since he relies on the wages of his master. As well, since the laborer has no profits to be gained from the production that he doing, he is alienated him from the process of the profit making, which is a violation of his freedom. Furthermore, Marx argues that the majority of the wo rking class should fight for their freedom and overcome the tyranny of the bourgeoisie (Marx 73). This seems like the views of Mill who argues that the citizens are to have freedom and the state, which is in small minority, should not exercise tyranny over them. Nevertheless, for Mill, the impediment to freedom is the â€Å" masculine state, † (Mill, 219). For example, Mill argues that men control the affairs in public life and hence the women are forced to perform the duties of the private life. This implies that the half of mankind who are women are not free. In conclusion, this essay argues that Marx and Mill both share similar understandings of freedom such as the possibility of progress in society, the views that hold that freedom is an end in itself, and the idea that human nature for self-determination must be valued. However, both Marx and Mill pursue a different road in their conclusion of the concept of freedom. As described above, Mill’s argument argues that masculine is the impediment to freedom. This is so because most of the domestic work is done by women. Marx on the other hand views that the impediment to freedom is the bourgeoisie. Marx believes that capitalism is the problem for freedom and hence advocated for communism. As well, Mill advocated for freedom without the intervention from anyone or from the state as long as their action done does not affect others. Mill also argues against the norms of society that require the individual to conform. As well, he argues that the state should not interfere in the individu al`s affairs as this is a violation freedom. On the other hand, Marx suggests that the individual cannot be separated from the society. Thus the state can intervene in order to bring the society together and prevent other people from acquiring all the wealth. Ultimately Marx’s vision of communism is valuable because it is a vision that allows for the critique of contemporary society. As well, I would in conclusion, I would argue that capitalist system denies the majority freedom. For example, Even if you desire to have a certain type of work, you are not free to choose your boss. On the same point the people who controls the means of production have the freedom to choose among the abundance supply of labour. I would agree that communism in which the means of production is owned by many could have been a good society for mankind. Capitalism denies the freedom of choices to many people especially the poor. It lead to a few of individual controlling all the wealth. NB: The word freedom has been used interchangeably with the word Liberty. Work cited: John Stuart Mill, â€Å"On Liberty â€Å"Broadview Press. Mill, J.S. 1869 The Subjection of Women. Friedrich Engels and Karl Marx. Robert C. Tucker. Ed. â€Å"The Marx-Engels Reader.†W W Norton Co Inc (Np); 2nd Revised edition: March 17, 1978. 1